                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-23.43 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAGATCACTCATCGGCACCGTCGTCATTATCTGCCTCGTCGTCATTTATGCCGTCGC
GGCGACGGCCATTGCATCGGCGACGCTGGCGCAATCGCCGTGGTGGGTGCATCTCGCC
TATTTCGTGCTGAGCGGGGTCCTGTGGATCCTGCCGGCGATGCTGATCATCAAATGGA
TGGCCGGTTCAAAAAAACAGGGCTAAgcgcagtcggctacaggacaccctgaggtcgcaattttataaacagattgtttgc
cgctcaacgatatagtccgaccgaaacaaccggagagagtggatgGTG

    Atu1240 Gene: Atu1240     GI: 17935143     BI number: Atu1240     GOG: COG5653     Description: conserved hypothetical protei            AA           A  A           C  A            TA            TA            GC           |  A           G  G            CG            CG            GC            GT            TA           A  |           G  |           G  |           T  |           A  |           A  |           A  |           C  |           T  |           A  |           C  |           T  |           A  |           G  |            TA            Cg            Gc            Tg           A  c           G  a   A        Cg A  T       Gt        ca A  G       Gc       a  c CG        Cg        gc TA        Cg        gc AT        Gc        at CG       |  t       cg T  G      |  a      a  a A  C      |  c       tg GC        Ta        cg TG        Cg        gt CG        Cg        gc GT        Ta        cg                         caattttataaacagattgtttgccgctcaacgatatagtccgaccgaaacaaccggagagagtggatgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5653 Protein involved in cellulose biosynthesis (CelD) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:59 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-10.80 kcal/mol Antiterminator: Size=74 nt.     Delta G=-23.43 kcal/mol Anti-antiterminator:   Size=54 nt.     Delta G=-10.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TCAGATCACTCATCGGCACCGTCGTCATTATCTGCCTCGTCGTCATTTATGCCGTCGC GGCGACGGCCATTGCATCGGCGACGCTGGCGCAATCGCCGTGGTGGGTGCATCTCGCC TATTTCGTGCTGAGCGGGGTCCTGTGGATCCTGCCGGCGATGCTGATCATCAAATGGA TGGCCGGTTCAAAAAAACAGGGCTAAgcgcagtcggctacaggacaccctgaggtcgcaattttataaacagattgtttgc cgctcaacgatatagtccgaccgaaacaaccggagagagtggatgGTG     Atu1240 Gene: Atu1240     GI: 17935143     BI number: Atu1240     GOG: COG5653     Description: conserved hypothetical protei            ac           t  a           c  g            gg            ga            cc           |  a           t  c            g            a            c            g            c           g  |           A  |           A  | AA       T  | A  A      C  | C  A      G  | TA       G  | TA       G  | GC       A  | |  A      C  | G  G      A  | CG       A  | CG       A  | GC       A  | GT        A TA        A A  A       A G  g       C Gc       T Tg       T A  c       G A  a       G        ca A  |       C       a  c C  |       C        gc T  |       G        gc A  |       G        at C  |      |         cg Tg       |        a  a At       |         tg Gc        T        cg Tg        A        gt Cg        G        gc Gc        G        cg                         caattttataaacagattgtttgccgctcaacgatatagtccgaccgaaacaaccggagagagtggatgGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG5653 Protein involved in cellulose biosynthesis (CelD) ... can be seen here     ..................................................................................................................