                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:183 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAAAACTGGACAGAAATAGTCAATAAAATCCGAATTCCCGTGTTTGGTGAAATCA
TTTTGCGTGGACAAAAAGCGACCGCTGCAGGACGATGAACTTTCCGTGGCAGCGATTT
TTGGCCGGGCAGGGGTTCAAGAGAACGGAGAGGCTTCCTAGATGGGAAGGGTGGGCGC
AAtcgccggcgtcagggatgtgttcgcgaaatcatgcaggagacgctatcctggcggggctttcggatggcgaacttgcgctggcattcttcaaaccag
gtgacgttccagaagggataagttgacATG

    Atu1250 Gene: Atu1250     GI: 17935153     BI number: Atu1250     GOG: COG1832     Description: conserved hypothetical protei GT T  T GT CG CG |  T CG         A TA       A  A TA       A  G A  A      A  C AT       C  G       GA GC       A  A      T  A C  |       GC       A  C C  |       GC       G  T TA        TG       C  T AT        GC        AT AT       |  T       GC AT        CG        GC AT        GC       |  G TG        TA       |  T |  C       TG       A  G |  G       TG        CG A  T       TA        GC A  G      A  C       TA CG        CG        CG TA        TA        GC GC        AT        CG                         ATTTTTGGCCGGGCAGGGGTTCAAGAGAACGGAGAGGCTTCCTAGATGGGAAGGGTGGGCGCAAtcgccggcgtcagggatgtgttcgcgaaatcatgcaggagacgctatcctggcggggctttcggatggcgaacttgcgctggcattcttcaaaccaggtgacgttccagaagggataagttgacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1832 Predicted CoA-binding protein ... can be seen here     ..................................................................................................................