                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-21.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttcaggctcacgaggaaacatgttttgacgcgctcatgccattatcaggtgtgaggtggccttcgaaagctctttcgggcggcccggtttcacccctta
tggtgtggattgaaagtctcgaggcgcctgtgtagcttccattcggacacacggcgtttcgaaaagcggaatgtgcgcataaacacgaaagcccggcctc
catggccgggctttttgattctccgccataaaatgtcatgccactgtcacgtctttgacgcagaagccatggggtgtttctggatccaagggggattaaa
ATG

    Atu1263 Gene: Atu1263     GI: 17935166     BI number: Atu1263     GOG: NOG05087     Description: conserved hypothetical protei tt a  c        t cg       a  g cg       a  t ta       g  g t  c       gc c  |       cg g  |       gc a  |      |  a ta       |  t gc       |  a ta       a  a gc       a  a t  |      a  c        c cg       a  a      c  a cg        gc       t  t gc        cg        cg cg        ta        cg gt        ta        gc gt        ta        gc at       g  |       cg gc        cg        cg cg        gc        cg ta        gc        gc                         tttttgattctccgccataaaatgtcatgccactgtcacgtctttgacgcagaagccatggggtgtttctggatccaagggggattaaaATG     ..................................................................................................................