                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -9.29 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTGAAGCCGGGCAAGATCGGTGGCGAGCTGCCGCTGGTGGCCAAGCAGGAAGCGCA
TGATTTCCTGCCCGATCTCAAGGCGCAGACCAACGGTTACGTCGTCGACAAGCTTGAA
GGCTTCACCTTCGACAAGGCGGGAACAGCGTATGCCGTGACCGACAATGACGGTGTGG
ACGATTCTTCTGGCGAGACGCTGTTCTTCACCGTCAATCTGAAAGCCATCAACTGAtc
gtgccgagtggcgttacaaatgagaaaagccgggcatagcccggcttttttgtatcgccaagagacccATG

    Atu1264 Gene: Atu1264     GI: 17935167     BI number: Atu1264     GOG: -------     Description: hypothetical protei at a  g a  a c  g a  a t  a t  a g  a cg gc         t gc       a  a tg        cg g  |       gc a  |       gc g  |       gc cg        cg cg        cg gc        gc ta        at gt        at             ttttgtatcgccaagagacccATG     ..................................................................................................................