                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:65 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCCGCCGCAAGGGTGCGTCCATCGCGTTGGAAGCGGCCAATCCTGCCTACGAGACC
CGCATTTTTGGACCGGATCGGGTGAAGATTCAGGGCAAGCTGGTCGGGTTGATACGCC
GTTACCATTGAtagctggaggctgctgccggtattactgaaaccgaataggttttcacgggtagatttggctttcgaaatgaatggcgcatc
gttccgttgaattgatgcgccttttctttgtgagattggcaaacgcactcgttgctgcgaaattccgtcgtgtatgacggcccctccatcaaTTG

    Atu1394 Gene: Atu1394     GI: 17935294     BI number: Atu1394     GOG: COG0625     Description: glutathione S-transferas   a a  t g  a cg cg at at at gt         a t  c      a  a c  |      g  t a  |       cg t  |       ta t  |       ta a  |      |  t ta        tg gc        cg        gt g  g       gc       c  t cg       g  g       cg cg       t  c       ta gt       t  |       ta ta        ta       |  t cg        at        gt |  a       gc        cg |  t      a  g       ta |  t      t  t       at g  t       gt        cg tg        gc        gc cg        gc        cg gc        cg        gc gt        at        gc                         ttttctttgtgagattggcaaacgcactcgttgctgcgaaattccgtcgtgtatgacggcccctccatcaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0625 Glutathione S-transferase ... can be seen here     ..................................................................................................................