                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-14.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -9.42 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCCAGCAACACATTCGACGTCATCCTCGGCCTTGTGCCGAGGATCTGCCAACGTCT
CCTCAATTTCGATACGTTGCAGATGCTCGGGACAGGCTCTAGCATGACGAAGGAGAGT
TTGACGGTACCATCGCCACCCTAAgcccgccctccggcgggctttttcatgccgatctgccgattggaatttaaggtcaacg
gatagttaaacaatccggcttagtctcagaatcacgttgtgcgttttagggcttttctccggcatgtggaccagacatcataaaaaaagacgattcggcc
gtTTG

    Atu1428 Gene: Atu1428     GI: 17935328     BI number: Atu1428     GOG: COG2919     Description: conserved hypothetical protei   A        CA G  C      C  T T  G      A  C A  A       TG C  A       GC G  G       GC A  G      |  A TA       |  C CG       C  C TA       A  C CG        GT GT        TA GT        TA AT        Tg CG        Gc A  A      |  c       tc G  |      |  c      c  c G  |      |  g       cg GC       |  c       cg CG       A  c       gc T  |       Gc        cg CG        At        cg GT        Gc        cg TA        Gc        gc                         tttttcatgccgatctgccgattggaatttaaggtcaacggatagttaaacaatccggcttagtctcagaatcacgttgtgcgttttagggcttttctccggcatgtggaccagacatcataaaaaaagacgattcggccgtTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [D] COG2919 Septum formation initiator ... can be seen here     ..................................................................................................................