Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_circular

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -7.16 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G=-18.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTCGACAAGAAGACCGGCGAACTGCTCGGTGCCCATATGGTCGGTGCGGAAGTGAC
CGAACTCATTCAGGGCTTCGTCGTTGCCATGAACCTCGAGACGACGGAAGAAGATTTG
ATGCACACGATCTTCCCGCATCCGACCATTTCGGAATCAATGAAGGAAAGCGTGCTCG
ACGCTTACGGACGTGTGCTGAACGCATAAgtgtcccgtgatgcccggcattgtctaaccttgccgggtgtcccatatgt
ctcaacgccggttcctcaagggaactgttctttcagggagcgtgggaATG

    Atu1435


Gene: Atu1435     GI: 17935335     BI number: Atu1435     GOG: COG2261     Description: conserved hypothetical protei


  t
c  a        a
 ta       t  t
 gc       a  g
t  c      c  t
t  t      c  c
 at       c  t
 cg       t  c        a
 gc       g  a      c  a
 gc        ta       t  g
 cg        gc        cg
 cg       |  g       cg
 cg        gc        ta
 gt        gc        ta
 tg        cg        gc
 at        cg        gt
 gc        gt        cg
                        ttctttcagggagcgtgggaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG2261 Predicted membrane protein ... can be seen here

    ..................................................................................................................