                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gatatcgctgcgactgaaagacgtcgcagccgaaggacagacggtgacagcgctggcaccgtttcgtgccgatgacggcaggcttttttcctttccgtcc
gcacagtggcaaggcgcgttaagaacccctcccctgaaactgcggccgggcaaagcaccgcctgagctttttctcgatgtgatcctgcagcccggttctc
aaccgattgagatcgatgtttcctgcatcgacatccaccccatttcaaatccggtgcgcgcatgaaacattctcaggacaaaccacgcctgctgattgcg
ATG

    Atu3027 --- Atu3028 --- gudD Gene: Atu3027     GI: 17936738     BI number: Atu3027     GOG: COG0111     Description: dehydrogenase Gene: Atu3028     GI: 17936739     BI number: Atu3028     GOG: -------     Description: conserved hypothetical protein Gene: gudD     GI: 17936740     BI number: Atu3029     GOG: COG4948     Description: glucarate dehydratas cc c  t c  c a  c a  c gc at |  g a  a ta ta        gc gc       a  a |  t      a  c cg       a  c gc        cg |  g       gc cg        gc gc        gt gc        cg a  g      |  a a  g       cg cg        gc gc        gt             ttttctcgatgtgatcctgcagcccggttctcaaccgattgagatcgatgtttcctgcatcgacatccaccccatttcaaatccggtgcgcgcatgaaacattctcaggacaaaccacgcctgctgattgcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [HE] COG0111 Phosphoglycerate dehydrogenase and related dehydrogenases ... can be seen here [MR] COG4948 L-alanine-DL-glutamate epimerase and related enzymes of enolase superfamily ... can be seen here     ..................................................................................................................