                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:105 nt.     Distance to run of Ts=2 nt.   Size=29 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=23 nt.     Delta G=-13.70 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-21.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCCCATCGCGTAGATCGGCCTTGAGGGCGATCGCCTTCGAGCCGAGGGCTTCGATC
TCGCGGATCGTCGCCTGCGCGGCATCGGGGTTTGCGCCATAATGGACGCCGATAAGAC
CTGCGCCCTCCTTGGCAAATGCCAGGGCGGCGGCACGGCCGATGCCCCTTGAACTTCC
CGTTATGAGGGCGACTTTGTTCGACAGTTTCTGAGACATggatctctccgttgcgatttaactagcgatcg
atataataaaagccgaacatgatctgtcaacatttttatagtgatcgatataataATG

    Atu3075 Gene: Atu3075     GI: 17936786     BI number: Atu3075     GOG: COG1309     Description: transcriptional regulator, TetR famil AA A  T CG GC GC TA TG                   C CG                 T  C CG                 T  C T  C        C        CG C  |      A  G       AT CG        CG        AT CG        GC       G  A GC        GC       T  T |  G       CG       T  G CG       G  A      C  A GC        GT        CG TA        CG        CG |  C       GC        CG CG        GC        GC CG        GC        TG                         ACTTTGTTCGACAGTTTCTGAGACATggatctctccgttgcgatttaactagcgatcgatataataaaagccgaacatgatctgtcaacatttttatagtgatcgatataataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1309 Transcriptional regulator ... can be seen here     ..................................................................................................................