                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:122 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.60 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGACGACATCGATTCGAGCGCCGGCCAGACCTTTCGCTGCCACTTCGCGGCGGGCC
GCTTCAAGGATCGCGGCCCGGGTTCTTTCAGGGTTCCGTACCTGTGTTGTCGCGCGTT
TGCGCTTGGGCGGTAGCGTTTCTTCCGGGGCCGCATCGAGTGGCTGGTTTTTTGTCGT
TTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatc
atcaattggcagtcaatagggaggagttgccaATG

    Atu3114 Gene: Atu3114     GI: 17936825     BI number: Atu3114     GOG: COG1653     Description: ABC transporter, substrate binding protein [sugar TT T  G        C GC       T  T CG       T  T GC       T  C |  T       GC         C |  T       CG       T  G |  G      G  G      A  A |  G      A  G       CG CG        TG        GT GC        GC        CG CG        GC        CG T  G       CG        GC G  T       GC        GT TA       |  A      G  | TG        GT       G  | GC        GC        CG TG        TG        CG                         TTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaattggcagtcaatagggaggagttgccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:130 nt.     Distance to run of Ts=1 nt.   Size=17 nt.     Delta G= -8.10 kcal/mol Antiterminator: Size=32 nt.     Delta G= -9.10 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGCGACGACATCGATTCGAGCGCCGGCCAGACCTTTCGCTGCCACTTCGCGGCGGGCC GCTTCAAGGATCGCGGCCCGGGTTCTTTCAGGGTTCCGTACCTGTGTTGTCGCGCGTT TGCGCTTGGGCGGTAGCGTTTCTTCCGGGGCCGCATCGAGTGGCTGGTTTTTTGTCGT TTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatc atcaattggcagtcaatagggaggagttgccaATG     Atu3114 Gene: Atu3114     GI: 17936825     BI number: Atu3114     GOG: COG1653     Description: ABC transporter, substrate binding protein [sugar   G C  C G  T T  T TG TG G  G C  C GG         C CG       T  G GT       A  A CA        CG TG        GT |  C       CG GG        CG TT        GC TT        GT             GGTTTTTTGTCGTTTTTTCCATttcagcacccgcttgacaatgttggtgatcggtgttcccatgtaaccaattagttataaaacggcaagtgtcgtttacgttcatcatcaattggcagtcaatagggaggagttgccaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................