Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear
Characteristics of the secondary structures
Terminator: Distance to gene:167 nt. Distance to run of Ts=0 nt. Size=39 nt. Delta G=-13.92 kcal/mol
Antiterminator: Size=43 nt. Delta G=-10.40 kcal/mol
Anti-antiterminator: Size=46 nt. Delta G= -7.20 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CCGCCGTTGTCAGGCTGAATGAAGCCGAAGCCCTTGGTGGCGTTAAACCACTTTACAG
TACCAGTGTTCATaacgatctcctttttagaatcgttgtggttcccgcgataccttgcgggattagatcgatttttgagaggaaatccgac
ggggaacacgaggttccggtaacgacgtcacaagcaatggtcgatggagataaatataggcacaattttcgattttgcaatgaccgggcccggaaaatag
ggttcgttccccatttgatggtttaaccgattgttttataagtaaaatatcTTG
Atu3120
Gene: Atu3120 GI: 17936831 BI number: Atu3120 GOG: ------- Description: hypothetical protei
AG t
C T t t
A A c t
T C c t
T C ta ac
TA cg t c
CG | a at
AT ta gt
CG at cg
| T gc gc
C T cg cg
A C at cg
A A at cg
AT Tg ta
Ta At t t
Ta Cg g t
Gc Tg g a
Cg | t t g
| a | t g a
Gt | c t t
Gc T c t |
T t Gc gc
Gc Tg cg
Gc Gc ta
tttttgagaggaaatccgacggggaacacgaggttccggtaacgacgtcacaagcaatggtcgatggagataaatataggcacaattttcgattttgcaatgaccgggcccggaaaatagggttcgttccccatttgatggtttaaccgattgttttataagtaaaatatcTTG
..................................................................................................................