Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear
Characteristics of the secondary structures
Terminator: Distance to gene:71 nt. Distance to run of Ts=1 nt. Size=39 nt. Delta G=-11.70 kcal/mol
Antiterminator: Size=49 nt. Delta G=-11.70 kcal/mol
Anti-antiterminator: Size=37 nt. Delta G= -5.80 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ggacaagacgaaaacacctgccgcggcgccagccggttcgcaggtgaagttcgcaaacgccacggcagcggatggcaaaaagaagtagggcacggcatcg
gccggcaagtcacgacgataaaagtatcattatggatgccggacttgttttggccacattgccctactagatagttcttatagcaactgctggtgagcgc
gaatgaaattgtcgttcgcagttgttttgtcgcttcagacttttgaccacggatgtactggcactggtgttaagagcgatatgaggaaggtcggtgcaat
ATT
Atu3125
Gene: Atu3125 GI: 17936836 BI number: Atu3125 GOG: ------- Description: hypothetical protei
at
t a
t g
c c
ta ga
ca ta t a
a t gc a a
c t at at
cg tg gt
gc a | cg
gc gc | t
t c at gc
t t tg cg
t | cg gt
ta at at
gc | g gc
| t ta t |
| a cg g |
| g c c g |
| a cg t |
t t gc cg
ta | g gc
cg ta ta
at ta cg
gt at at
gc cg at
gttttgtcgcttcagacttttgaccacggatgtactggcactggtgttaagagcgatatgaggaaggtcggtgcaatATT
..................................................................................................................