                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCATCGGTATCCGCCCGCAGCATCTTTCGCTGGCGGGGGAAGCCGGTGGTCCGGCGCT
GGAGGCGAAACTCACCAATGCGGAGTTCATGGGGCACGAGGTCTATCTGCACGCCGAT
CTCGGTGGCCAGAAGCTGGTGAGTGTTGTGGGTGCGGCAGAATTCGAGGCGCTCGGGC
GCGACGGCATCCTGCGGCTGAAACCGGACCCGGAGAAGCTGCATATTTTCGACAAGGC
CGATGGCCGCAACGTCTCGCTGTGAggaggggacgggcgtgcctgatttttcgaggaggagaacaacaATG

    Atu3130 Gene: Atu3130     GI: 17936841     BI number: Atu3130     GOG: COG1653     Description: ABC transporter, substrate binding protein [sugar            AC           G  G            CG            GC           C  A       AC           G  T      G  C            GC        GC            GC        CG           C  T       CG           T  |      A  A CG        CG       A  G T  G       GC       A  A CG        CG       G  | GC       G  G       TA CG        GC        CG GC        AT        GC G  G      G  |       GT A  A       CG        CG GC        TA        GC CG        TA        TA                         TATTTTCGACAAGGCCGATGGCCGCAACGTCTCGCTGTGAggaggggacgggcgtgcctgatttttcgaggaggagaacaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................