                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-31.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-11.60 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-10.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAAGACCAGAAGCTGCTGCGCCAGGCGGCCAAGGATTCGGTCGGCAAGATGCGCGA
ACTCTGGAGTGCCCGCGAAAAAGCGTCGGAAGAAAAAGTCCGCGCCGGTGGCGCCAAC
GTCATCAAGGTCAACAAGGAGGAATTCGCTGCGGCGATGGGTCCGGTCTACGACAAGT
TCGTCACCGACCCGAAGATGAAAGACCTTCTGGAACGGGTGAAAGCGGTCAAGTAAcg
cgcggaaaaccggccctggaaacagggccggttttcttttgttgccgttgatgcgggaggaacagacaATG

    Atu3136 --- Atu3135 Gene: Atu3136     GI: 17936847     BI number: Atu3136     GOG: COG3090     Description: ABC transporter, membrane spanning protein [C4-dicarboxylate] Gene: Atu3135     GI: 17936846     BI number: Atu3135     GOG: COG1593     Description: ABC transporter, membrane spanning protein [C4-dicarboxylate   A G  C A  C AT        AG AT       A  T GC       C  A T  T       TA A  G       Gc G  G      |  g       aa A  A       Gc       g  a A  A       Cg        gc GC        Gc        ta CG       A  g       cg CG       A  g       cg CG       A  a       cg AT       G  a       gc |  G      T  a       gc |  A      G  a       cg |  A       Gc        cg |  A       Gc        at |  G       Cg        at GC       A  g       at CG       A  c       at CG        Gc        gc AT        Gc        gt                         tttgttgccgttgatgcgggaggaacagacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3090 TRAP-type C4-dicarboxylate transport system, small permease component ... can be seen here [G] COG1593 TRAP-type C4-dicarboxylate transport system, large permease component ... can be seen here     ..................................................................................................................