Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cccccgcgatgtcgcgttataattgttttatggaatttttatagggcatgtatttcggcggtgtctgctaaataattcaacaaagtttagatgcgattaa
gaattagtccgtctttttatagtcgttgctgatacgctgcgtcacgggcctgtacctgtggttgaaaaaaccggtctggcggaaacgcagcgcggggtta
ttttacgccgcccggttgatcatggctgtggtgattggccttgccaagtggccgagaaacggcatgttgagcgcgacatgcgggtttcagggaagatatc
ATG

    gatA


Gene: gatA     GI: 17936954     BI number: Atu3243     GOG: COG0154     Description: glutamyl-tRNA amidotransferase subunit


            a
          c  a
          t  c
          t  a
          a  a
          a  a
           tg
           at
           at
           at
           ta
           cg         a
  g       g  a      g  a
t  t      t  t       at
 gc       c  |       at
 gt        tg        ta
 cg        gc        tg
 gc        tg        at
 gt       g  a       gc
c  |      g  t      c  |
 ta       c  t       gc
 ta       g  a       tg
 ta       g  a       at
 at        cg        gc
 ta        ta        at
                        ttttatagtcgttgctgatacgctgcgtcacgggcctgtacctgtggttgaaaaaaccggtctggcggaaacgcagcgcggggttattttacgccgcccggttgatcatggctgtggtgattggccttgccaagtggccgagaaacggcatgttgagcgcgacatgcgggtttcagggaagatatcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here

    ..................................................................................................................