                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-19.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-10.40 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTGACGACACGCAACGCCATCCGGGCTTTCTGAtactcggcatcccgacgccccatcaaagccgccccggaaac
gaggcggcttttttcattggccgaacctgacgatgaccgggcaaccttgcccgaaagtgctcgagcccctgcgtggcaaggcgatgcagccgtggcattg
tcgccgccattacaaaagtttaaggtgatttcgcagcgcattgggtgtcttgtgggggaaagctgctcccaaggcttgccgcacatgttcgggaaacatg
tactctcattacgcggaatcgtcagATG

    Atu3273 --- Atu3274 Gene: Atu3273     GI: 17936984     BI number: Atu3273     GOG: COG0845     Description: HlyD family secretion protein Gene: Atu3274     GI: 17936985     BI number: Atu3274     GOG: COG0841     Description: AcrB/AcrD/AcrF family protei            cc   G       c  g G  C      t  a G  T      a  c T  T       cg AT        gc gC        gc aT       c  c cG       t  c tA       c  | |  t      a  |       aa |  a       ta       g  a |  c       At        gc |  t       Gc        cg gc        Ta       c  a cg       C  |       cg tg       T  |       cg |  c       Ta        gc a  a       Ta        cg at        Cg        cg gc        Gc        gc gc        Gc        at                         tttttcattggccgaacctgacgatgaccgggcaaccttgcccgaaagtgctcgagcccctgcgtggcaaggcgatgcagccgtggcattgtcgccgccattacaaaagtttaaggtgatttcgcagcgcattgggtgtcttgtgggggaaagctgctcccaaggcttgccgcacatgttcgggaaacatgtactctcattacgcggaatcgtcagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0845 Membrane-fusion protein ... can be seen here [V] COG0841 Cation/multidrug efflux pump ... can be seen here     ..................................................................................................................