                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATAATCAATAAAGTTCCATTTATAGGAGCAACGGCATTTTTTTGTTTTGCTGCATAA
TCTGACGTTCCCATGAACATTGACGCCTCCCTAAAGCGCTTACGCATtacattcttttggctaag
cagttcatcgggagttcccccggatacttaggggcgcttcccgcttcaggccatgtcaactatcattaatcacccgttaattaacgtaagctaatacgaa
aagctgtgtaaataaatggcccaaacgggttattttttacaattgacatacaaaataggttacggccggacagaatcATT

    Atu3319 Gene: Atu3319     GI: 17937027     BI number: Atu3319     GOG: -------     Description: hypothetical protei   c a  g t  a a  a a  a ta cg gc at a  g t  t g  | cg at a  a ta        aa ta       a  c at        cg a  a       cg ta        cg ta        gt gt        gt cg        ta cg        at             tttttacaattgacatacaaaataggttacggccggacagaatcATT     ..................................................................................................................