                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-25.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-15.30 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-24.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATACCCGCTGCTCGCTGGAGCGCTCGCTGCACGGCATCGATGTGATGACCTCGATC
CTGAAGTCAGGTGAAGAAGGCCGTTTCATTGAGATGAACACGACCTGCACGCAGCCGG
CAGCCCTTGGCATCGAGGAGGCGCAGGCGCTGCTGCGCTGAggcttggatgatccggaaagcggcggagg
ggacttcgccgctttcgtgtttttaccgcaacccttcacaatcccttccttttggtttaaagccgcgccgtatccggtcgcagcccacccggtcaaaaca
agggatcccaacttATG

    exsB --- Atu3345 --- exsD Gene: exsB     GI: 17937054     BI number: Atu3346     GOG: COG0603     Description: succinoglycan biosynthesis regulator Gene: Atu3345     GI: 17937053     BI number: Atu3345     GOG: COG0720     Description: 6-pyruvoyl tetrahydropterin synthase Gene: exsD     GI: 17937052     BI number: Atu3344     GOG: COG0602     Description: radical activating protei   A G  G CG TA         g A  G      t  a CG       a  t GC        gc |  G       gc GC        tg TA        tg TG       c  a       gg CG       g  a      g  a C  C      g  a       gc CG       A  g       at GC        Gc        gt AT        Tg        gc CG        Cg        cg GC        Gc        gc GT        Cg        gc CG       G  g       cg |  C       Ta        gc CG        Cg        at GC       G  g       at AT        Tg        at CG        Cg        gc                         gtgtttttaccgcaacccttcacaatcccttccttttggtttaaagccgcgccgtatccggtcgcagcccacccggtcaaaacaagggatcccaacttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0603 Predicted PP-loop superfamily ATPase ... can be seen here [H] COG0720 6-pyruvoyl-tetrahydropterin synthase ... can be seen here [O] COG0602 Organic radical activating enzymes ... can be seen here     ..................................................................................................................