                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=37 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATAAggcgtggggcaatctggttcgtcccctcaccttcgcgtgacggagagcccctgtcacggaggcgttttgcgccaaccctcaagaacggccgg
tttcgcctgccgttcttttctgctttataacaaggcaggccattctggcgacgcccgtccggcagcacccgcaataacagcatggatttccgatgcagga
ttcgtttacagcgcgcttcattgaactcgccgcgcatctcggcctcaactatgattttctgaacagcggttacgaggttcagatctggcttgatggcatg
aagATG

    Atu3358 --- Atu3359 Gene: Atu3358     GI: 17937066     BI number: Atu3358     GOG: COG0765     Description: ABC transporter, membrane spanning protein [amino acid] Gene: Atu3359     GI: 17937067     BI number: Atu3359     GOG: COG0765     Description: ABC transporter, membrane spanning protein [amino acid             c           g  g           t  c           t  c            ta   g        ta a  c       gc g  c      c  | a  c       gc gc        gc gt        at cg        gc at       g  a        t gc       c  a      t  c ta       a  g      t  g gc       c  a       gc cg        ta        gc g  |       gc       c  t cg        tg        cg ta        cg        gc tg       |  c       gc cg       c  c       cg |  c       cg        at cg        cg        at at        gt        gc                         ttttctgctttataacaaggcaggccattctggcgacgcccgtccggcagcacccgcaataacagcatggatttccgatgcaggattcgtttacagcgcgcttcattgaactcgccgcgcatctcggcctcaactatgattttctgaacagcggttacgaggttcagatctggcttgatggcatgaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here [E] COG0765 ABC-type amino acid transport system, permease component ... can be seen here     ..................................................................................................................