                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:210 nt.    Distance to gene:13 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.90 kcal/mol
Antiterminator:    Distance from promoter:165 nt. Size=58 nt.     Delta G=-11.40 kcal/mol
Anti-antiterminator:    Distance from promoter:140 nt.    Size=32 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatg-tatatt. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatgcatagtttgtctaccgattttatattctaataaaggatgtTTGTTCCATGCTGCGAGGAGAACAGAGAAAA
TATTGTTTTCAGTCAGGTTTTCGAAGTCTGCCTTGATCGGGGCGCTCGAAAACGCTGA
AAACCTTGCCTCAAAGGACTGCTACAGGGCGCTTTCACCGGAGAACGCACTGAAACGG
GCTTGCACCGGAATTCGCTAAaaactactaagtaacttaggaacattacgatccggcattgtgaatatgccggttctcttttcgg
atcaggcgATG

    Atu3423 Gene: Atu3423     GI: 17937131     BI number: Atu3423     GOG: COG1959     Description: conserved hypothetical protei             a           t  a            gc            at            at            ta            cg           a  g           t  a           c  a           a  c           a  a           a  |            At            At            Ta   A       C  | A  A       Gc GC        Cg TG        Ta         g CG       T  |      t  a A  |      A  |      g  a CG        At       t  t GC        Gc        ta C  T       Gc        at A  T       Cg        cg A  G       Cg        gc G  C      |  c       gc A  A      |  a       cg GC       |  t       cg GC        At       t  t CG        Cg        at CG        Gt        gc                         tcttttcggatcaggcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1959 Predicted transcriptional regulator ... can be seen here     ..................................................................................................................