                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:14 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATCAGTTCGTCGCCAACCAGTTTGCCGGTATCGGCGGCCTGAAGGGCCCGGACCGGT
ATCGCGGTGCGGAATGGACAAGGCTGGCAAGCGGGGCCCCCATCCTCGAAGATGCCGT
GGCGGCGATCGATTGTACCATCGAAGAGACGATCGAGCGTCACAGCCACGTCATCGTC
ATCGGCAAGGTGGAGGCGATCCGTGTCGGCTCCGGCCATTCGCTGCTCTACCAGAACG
GGCGTTATCATTCACTGGACTGAgcgtctgtcgtttcggcgctttcattttgtcattgtttgagggagTTG

    Atu3424 Gene: Atu3424     GI: 17937132     BI number: Atu3424     GOG: COG1960     Description: hypothetical protei   T A  T C  C CG GC GT CG |  C |  T       CT C  C      A  G T  T       CG C  A       TA GC       T  C GC        AT C  A       CG        gt T  G       TA       c  t G  A      A  |      t  t TA       T  |       gc GC        Tg        tg CG        Gc        cg CG        Cg       t  | TG        Gt        gc A  |       Gc        cg GC        Gt        gc CG        Cg        At GT        At        Gt                         tcattttgtcattgtttgagggagTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here     ..................................................................................................................