                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-23.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAATCCGAAGGTGGATGCGCTGCTTGAAGCCGCCGCCATCGAGATCGATCCGGACA
AGCGCGTGGCGCAATGGAAGGAAATCCAGCAGATCCTCGTTGAGGACGTGCCGGCGAT
CGACATCGTCGCAGCACCTGAAATCACCATCTTCAACAAGCGCATCGCCGATCACACC
ATCGGCGCCGAAGGTGTCGCGGGAAGCCTCGCCTTCGCGCATATCGCCGCATCCTGAt
tgtctcgccagacccggctcccctttttgcgggagccggtatttttccctttcatcgaggccaaagccATG

    Atu3432 --- acd Gene: Atu3432     GI: 17937140     BI number: Atu3432     GOG: COG0715     Description: desulfurizing enzyme Gene: acd     GI: 17937139     BI number: Atu3431     GOG: COG1960     Description: acyl-CoA dehydrogenas   G G  A G  A CG GC C  C T  T GC TG GC GC AT        tc AT       g  t GC       t  c CG       t  g       tt |  C      A  c      t  t CG        Gc       t  g GC        Ta       c  c |  A       Cg        cg |  T      C  a       cg |  A      T  c       cg |  T      A  c       ta |  C      C  |       cg CG        Gc        gc GC        Cg        gc GC        Cg        cg CG        Gc        cg                         tatttttccctttcatcgaggccaaagccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0715 ABC-type nitrate/sulfonate/bicarbonate transport systems, periplasmic components ... can be seen here [I] COG1960 Acyl-CoA dehydrogenases ... can be seen here     ..................................................................................................................