                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:115 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-10.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G=-17.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggggtattttCTATAGATAAAGTGTACTATTTAAGGCGCCATTGGAGAAATTCGTTTCCGTC
ATGACCTCGCCTGAGCGCGACGACGGAATATCCTTTCGAGAATTTCGGGATTTCTGGT
CGGATCGTCGCCCACTTGTTTGATCGCATCCTCCATTCAGCTGCACGTCGGCTGAAAG
TTTTTCTTCTCCGAACAGCAAggatttttaactcgcgaccccaaccccggctgttaggttttcggataatcgcaccggccgcagg
ccggacagcccacgcggaccgaaagaaaagtagaagcATG

    Atu3450 Gene: Atu3450     GI: 17937158     BI number: Atu3450     GOG: COG2141     Description: nitrilotriacetate monooxygenas   A A  T        C GT       G  C AT       C  C GC        TA CG        GC T  |      |  T T  |      C  T T  |       TG CG        AT CG        GT TA        GT AT        CG T  |       TA AT        GT AT        GC GC        TG GT       C  C CG       T  | |  G      T  | |  T       TA |  C       AT         C |  G       GC       A  G |  G       GC       C  T |  A       GT        GC AT       C  C       TG GC       T  C       CG CG       T  |       GC AT        TA        AT GC        AT        CG CG        AT        TA GC        GC        TA                         AGTTTTTCTTCTCCGAACAGCAAggatttttaactcgcgaccccaaccccggctgttaggttttcggataatcgcaccggccgcaggccggacagcccacgcggaccgaaagaaaagtagaagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2141 Coenzyme F420-dependent N5,N10-methylene tetrahydromethanopterin reductase and related flavin-dependent oxidoreductases ... can be seen here     ..................................................................................................................