                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=1 nt.   Size=26 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-14.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcctcccccgaggtggcagacattgtcggcgatatcgccgcaagcttccatgtccgcctcttgtgaagcaggagaatacaggcttttgcattggcggca
atgcgggcgatttttctgaaagaagagtgccggaaccgccgcccgaaacaacgccgcgcacgcatttcgctgcccttggcatatcgatttcggcggcgca
tgcttgacagctttcgacacctgtgacaacttgtgaatagttgtcagacaggattgcgcttttatccttgcgccggtcggtttctggcaagggaggaatc
ATG

    Atu3459 --- Atu3458 --- Atu3457 --- Atu3456 Gene: Atu3459     GI: 17937167     BI number: Atu3459     GOG: COG0601     Description: ABC transporter, membrane spanning protein Gene: Atu3458     GI: 17937166     BI number: Atu3458     GOG: COG1173     Description: ABC transporter, membrane spanning protein Gene: Atu3457     GI: 17937165     BI number: Atu3457     GOG: COG0444     Description: ABC transporter, nucleotide binding/ATPase protein Gene: Atu3456     GI: 17937164     BI number: Atu3456     GOG: COG1124     Description: ABC transporter, nucleotide binding/ATPase protei aa g  t a  a g  c g  a a  g cg gc |  t at        cg at       g  g g  t       gc t  g       ta gc        ta ta        at t  t       cg c  t       gc t  |       tg cg       t  | cg       t  | gc        tg cg        cg cg        gc             gatttttctgaaagaagagtgccggaaccgccgcccgaaacaacgccgcgcacgcatttcgctgcccttggcatatcgatttcggcggcgcatgcttgacagctttcgacacctgtgacaacttgtgaatagttgtcagacaggattgcgcttttatccttgcgccggtcggtttctggcaagggaggaatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [EP] COG1124 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here     ..................................................................................................................