                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.20 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-16.80 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-16.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CACCTCGCTCTGATCGACGGTCGTCTGTGCGGTCTCGCTCATgggtctgctccatattgctcttgcatt
gaagtcggatgattgatccccgaagtcaagaccggcggtctattccgcaggtaaattgtcggggggcgcattgccgcagatggaactgacacggcacctt
gtttgtttcatgctgcgttcatggaggaacgcgtattttccgatcgtggcagtatgcggaacgcatgctcgtccatcgaatatgatggatgccgacaagg
gcaaagcgggcctttgcttgaggagaaagaaGTG

    Atu3507 Gene: Atu3507     GI: 17937215     BI number: Atu3507     GOG: COG4991     Description: conserved hypothetical protei gg g  g cg tg gc tg t  c a  a at at tg        ca gc       g  c gc       g  c a  |      c  t cg        at gc        cg |  a       at |  g       gt |  a      t  t |  t       cg cg        at cg        at ta        gt        gg ta        gc       t  a a  c       ta       a  g t  t       at        cg cg       |  g       ta ta        gc        ta gc        at        gc |  a       cg        cg gc        gc        gc cg        cg        tg                         tattttccgatcgtggcagtatgcggaacgcatgctcgtccatcgaatatgatggatgccgacaagggcaaagcgggcctttgcttgaggagaaagaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4991 Uncharacterized protein with a bacterial SH3 domain homologue ... can be seen here     ..................................................................................................................