                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:75 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTATGAAGGCATCGCCCATGGCCGGGAAGGACAGGCGCTGAAATGGGTCAAGCCCCA
GGCGCTGCGCGATTATCCCATGCCGCCGGCCGATGAGCCGCTCATCCCCTTCCTTCAG
GATTTGCTGTAAgaatcgaggggcctctgaggccctcctgccttatcccgtcacagcttcgtgaaaacgcccttcgtgcacggttttgccg
tgccaaaacggggctttgttaagagatcgttcagcaccctctggcagattgttaagctaaagaagcggtaaactgcgcgagacgaggttggtcATG

    Atu3515 Gene: Atu3515     GI: 17937223     BI number: Atu3515     GOG: NOG09758     Description: conserved hypothetical protei             t aa       t  t g  a      t  g ta        gc gc        gc cg        cg |  c       at t  c       cg t  c       gc c  t      |  c g  t      |  a a  c      t  a cg       g  a at       c  a cg       t  c |  c       tg ta        cg gc        cg cg        cg cg        gc             tttgttaagagatcgttcagcaccctctggcagattgttaagctaaagaagcggtaaactgcgcgagacgaggttggtcATG     ..................................................................................................................