Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-20.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -8.03 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGCGCAGGGCGTGCCTGCCGCTTTCGTCCCGGCCGAGGAACGCGATCCCAACAACC
CCGCCACCTGGGGCCGTATTGGGCGCAATGAAATGTGCCCCTGCGGCTCGGGCAAGAA
ATACAAGCACTGCCACGGCGTTTACGAGCAGGCCTAAagccagggatttatgccagagatcaatcgcccgtaa
cccgcgttacgggcgattttgtttgcgccggatcattgctgctggtcggggtgttgactggtatcggcactttccatatgggagccggatcatcttgcgg
aaactgctttcATG

    Atu3521


Gene: Atu3521     GI: 17937229     BI number: Atu3521     GOG: COG0697     Description: permeas


  A
T  A
C  a       tc
 Cg       a  a
 Gc       g  a
 Gc        at        cg
A  a       gc       c  c
C  g      a  g       cg
G  g      c  c       at
A  g      c  c       at
G  a       gc        ta
C  t       tg        gc
A  t       at        cg
T  t       ta        cg
T  |       ta        cg
 Ta       t  |       gc
 Gt       a  |       cg
 Cg        gc        ta
 Gc        gc        at
 Gc        gc        at
                        ttgtttgcgccggatcattgctgctggtcggggtgttgactggtatcggcactttccatatgggagccggatcatcttgcggaaactgctttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here

    ..................................................................................................................