                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-20.60 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -8.03 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGGCGCAGGGCGTGCCTGCCGCTTTCGTCCCGGCCGAGGAACGCGATCCCAACAACC
CCGCCACCTGGGGCCGTATTGGGCGCAATGAAATGTGCCCCTGCGGCTCGGGCAAGAA
ATACAAGCACTGCCACGGCGTTTACGAGCAGGCCTAAagccagggatttatgccagagatcaatcgcccgtaa
cccgcgttacgggcgattttgtttgcgccggatcattgctgctggtcggggtgttgactggtatcggcactttccatatgggagccggatcatcttgcgg
aaactgctttcATG

    Atu3521 Gene: Atu3521     GI: 17937229     BI number: Atu3521     GOG: COG0697     Description: permeas   A T  A C  a       tc Cg       a  a Gc       g  a Gc        at        cg A  a       gc       c  c C  g      a  g       cg G  g      c  c       at A  g      c  c       at G  a       gc        ta C  t       tg        gc A  t       at        cg T  t       ta        cg T  |       ta        cg Ta       t  |       gc Gt       a  |       cg Cg        gc        ta Gc        gc        at Gc        gc        at                         ttgtttgcgccggatcattgctgctggtcggggtgttgactggtatcggcactttccatatgggagccggatcatcttgcggaaactgctttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................