                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:36 nt.    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -8.40 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=27 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=16 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcta-tagtgt. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgctacttggatacaagtatactagtgtccatagtgcttacgcaagtcggctgttgggagaaagagcgattaagggagggttccagtcgctttttgtgg
atgcaggccgtttcATG

    Atu3533 Gene: Atu3533     GI: 17937240     BI number: Atu3533     GOG: COG1879     Description: ABC transporter, substrate binding protein [sugar                       g            ga       g  g           g  g       at           g  a       gt            ta        gc            ta        gc           g  g      a  | ca        ta       a  | g  a       cg        ta cg       g  |       tg at        gc        at t  c       cg        gc tg        ta        cg cg        gt        gc gc        at        at                         ttttgtggatgcaggccgtttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1879 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................