Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.00 kcal/mol
Antiterminator: Size=50 nt.     Delta G=-15.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGATACGGCCAAGTAGTTTTCCGCCGTCACCTTGCCGCCGGTGCCGGCAAGGATACGC
GCCCATATGGCATTGGCACTGGCGCGCGATACCATCTGCGACACGACGATATGGGCAA
GGCCTGCAAAGCCGGGCTCATGAATGCGCAATTCCAGCGGGCCTGCTTTTTCGATGAC
GGGGCTGAGCGCAGGATCGAGGCGGGCGAGATGGTCCAGCCCTTCGCTGATGTCATCC
ATCCCGGTGATGATTTTCATATCGGTCATtccctaggccgccagccggctggcggggcactttaaaacATG

    gltX


Gene: gltX     GI: 17937296     BI number: Atu3589     GOG: COG0008     Description: glutamyl-tRNA Synthetas


 AC
C  G
A  A
 GC
 CG
G  A
T  T        C
C  |      G  A
 TA       T  A
 AT       C  A
 CG        CG
 CG        GC
A  |       GC
T  |      A  G
A  |      A  G
G  |       CG
C  |       GC         G
G  |       GT       C  C
C  |       GC       G  A
G  |       TA        TA
 CG        AT        AT
 GC        TG        AT
G  A      A  A       GC
 TA       G  A      |  C
 CG       C  |      |  A
A  |      A  |      T  G
 CG       G  |      A  C
 GC       C  |       CG
 GC        AT        TG
T  |       CG        CG
T  |      A  |       GC
 AT        GC        GC
 CG        CG        GT
 GC        GC        CG
                        CTTTTTCGATGACGGGGCTGAGCGCAGGATCGAGGCGGGCGAGATGGTCCAGCCCTTCGCTGATGTCATCCATCCCGGTGATGATTTTCATATCGGTCATtccctaggccgccagccggctggcggggcactttaaaacATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0008 Glutamyl- and glutaminyl-tRNA synthetases ... can be seen here

    ..................................................................................................................