                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -7.80 kcal/mol
Antiterminator: Size=57 nt.     Delta G=-22.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAAGAGCGCGTCGATGCGGCCGCCGGTCCGGGCTGCAACGGTGTCCACCAGCGCGGC
GATGGTTTCCGGCTTGGTGTAATCCATGATCAGGGTTTCGATGCCCTGATTTTCGAGC
GCGGCCATGTCGACGATGCGGCGCACGGTGGCAAAAACCCGCCAGCCGTCCCGCTGAA
GCGCGCCGGCGCAATAGGCGCCGATGCCAGAGGAACATCCGGTGATGATGATGACCGG
TTTTTCAGACATgttccgctccgccaatggtctttgcgccaagtcgcgcccaggtttacaaaattaaaTTG

    Atu3590 Gene: Atu3590     GI: 17937297     BI number: Atu3590     GOG: COG1295     Description: transporte   T A  A A  G CG GC CG GC GC CG C  A GT CG GC C  | G  | A  | A  | GC TA CG G  A C  | CG CG TA        AT |  A      G  G |  C       TA |  A       AT |  T      G  G |  C       TA GC        GC CG        GC CG        CG GT        CG             TTTTTCAGACATgttccgctccgccaatggtctttgcgccaagtcgcgcccaggtttacaaaattaaaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1295 Predicted membrane protein ... can be seen here     ..................................................................................................................