                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=21 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCCGGCCGGTGCTGAAATTCCGCCGTTATCTCGAACGTACCGGCCGCAGGCTCTGGC
CACTGTTTTCCGGTGTCATCGTGGTGGAAGCCCAGAAGCGTCTCTATCAGGGATTGCC
CGTTACCCAACGTGCTTCGCGCCGCGTTTTCGTGCCCGTGCTCGCGCCGCAGGGGGTG
CCCACCACCCGCACGACGGCAAGGCAGGGAAAGCCGCGCTGAccctcgacaaagcggccattccggtct
aatgcctccggcattgcttttgccgggttctccggcgtttttccaaaggtcgatcaaATG

    hisC --- tyrC Gene: hisC     GI: 17937319     BI number: Atu3612     GOG: COG0079     Description: histidinol-phosphate aminotransferase Gene: tyrC     GI: 17937318     BI number: Atu3611     GOG: COG0287     Description: prephenate dehydrogenas             c           g  t   c       t  t        t t  c      t  t      t  c cg        at       g  t cg        cg        gc gc        gc        gc ta        gc        cg at        cg        cg at        cg        gc tg        tg        tg                         tttttccaaaggtcgatcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0079 Histidinol-phosphate/aromatic aminotransferase and cobyric acid decarboxylase ... can be seen here [E] COG0287 Prephenate dehydrogenase ... can be seen here     ..................................................................................................................