                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-23.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.62 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-16.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGCCGCTCTGCGCTCCGTTGAACACCGTGGTGGCCTCGATGCCTTCCTTCTGAAGT
CCGGCGAAAACGAACTGAGCATGCGCGCTCGTCTCCTGCGCCGCCAGATCGCCAAGAA
GACTGCTGAAGCTGCTTAAtagcggctttgacatcatctgatattcagaaggcttgaatggcttttcgccgctcaagccttttgtt
tgtttcagattttaattgcatcgggttttgcggaaatcgtgtcagacgtttcgctccgatgtttggctccaactggtggcatcacccaggataaaaaaAT
G

    Atu3618 Gene: Atu3618     GI: 17937325     BI number: Atu3618     GOG: COG1738     Description: conserved hypothetical protei AA T  t        a Ta       t  t        t Cg       a  t      t  t Gc        gc       t  c Tg        ta        cg Cg        cg        gc Gc        ta        gc At       a  a       tg At        cg       a  c Gt        tg        at T  g      |  c       gc C  a      a  t       ta Gc       c  t       ta Ta       a  g       cg C  |      g  a       gc At       t  a       gc Gc       t  t       at A  a       tg        at At        cg        gt Gc        gc        at At        gt        cg                         tttgtttcagattttaattgcatcgggttttgcggaaatcgtgtcagacgtttcgctccgatgtttggctccaactggtggcatcacccaggataaaaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1738 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................