                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGCCTTAAAAGAACCCTTCACCTACACGTTTCGCGCGCGCGGTGGATGCTGCAGGTA
TTATACCGTAGAGGGTGCGGAAAAGTGCCCCACCTGCGTCCTGAAGTCAAATGAAGAG
CGTGACAACATTCTTCTCCAGGAAATGCGCGCCCATTTTTGCCTAAAATAAgattattattt
tcaataattttttttactcgggagtcccatagcgccgcctttgatcgtcttcagcatgagtgggcggatattgccgccttttgtctgaaacgcttatcaa
gtgcgcgggagcgggggcttcaATG

    Atu3687 --- fecB --- fecC --- fecD --- fecE_lrep_2 Gene: Atu3687     GI: 17937394     BI number: Atu3687     GOG: COG1629     Description: TonB-dependent receptor Gene: fecB     GI: 17937395     BI number: Atu3688     GOG: COG0614     Description: ABC transporter, membrane spanning protein [iron(III) dicitrate] Gene: fecC     GI: 17937396     BI number: Atu3689     GOG: COG0609     Description: ABC transporter, membrane spanning protein [iron(III) dicitrate] Gene: fecD     GI: 17937397     BI number: Atu3690     GOG: COG0609     Description: ABC transporter, membrane spanning protein [iron (III) dicitrate] Gene: fecE_lrep_2     GI: 17937398     BI number: Atu3388     GOG: COG1120     Description: ABC transporter, nucleotide binding/ATPase protein [iron (III) dicitrate   c t  a t  g c  c ta gt cg ta a  g g  t t  | t  | tg cg cg gc cg        at cg       t  t g  a      a  g c  |       gc g  |       gc at        cg ta        gc at        gc             ttttgtctgaaacgcttatcaagtgcgcgggagcgggggcttcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1629 Outer membrane receptor proteins, mostly Fe transport ... can be seen here [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here     ..................................................................................................................