                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -9.86 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACCCCAACCTTGGCAAGGTTGTGCTCTACCCCTGAGCTACACCCGCtcaaatccaccggtccgg
ggtagttcgctgaaccgtgggccaccaagcggcgacgggcgctatatcgctcaatcgattttggaatgcaacagagaaatgacaaaaacgcgaaaatttc
tttgagaaatgcgacaagcggcggaaatgattgagaatttttcacttcgccggtttttcctgcgttgccaagcgctggccgcccccttaatcaggaaaga
acgacaacggaatcggcggaggcgggcggcaggatATG

    Atu3699 --- trxA Gene: Atu3699     GI: 17937406     BI number: Atu3699     GOG: COG3760     Description: conserved hypothetical protein Gene: trxA     GI: 17937405     BI number: Atu3698     GOG: COG3118     Description: thioredoxi             a           a  c           a  g           a  c           a  g           c  a           a  a           g  a            ta            at            at            at            gc            at            gt            at            cg at       |  a t  a      |  g c  t      |  a gc       |  a        a cg       a  a      g  a gc        at       a  t gt        cg       g  t gc        gc       t  t |  a       tg       t  t c  a      a  a       at at       a  |       gc gc       g  |       ta cg        gc       a  c g  a       ta       a  | g  t       ta        at c  |       tg        gt gt       |  c       gc at       t  g       cg at       a  g       gc cg        gc        gc cg        cg        cg                         gtttttcctgcgttgccaagcgctggccgcccccttaatcaggaaagaacgacaacggaatcggcggaggcgggcggcaggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3760 Uncharacterized conserved protein ... can be seen here [O] COG3118 Thioredoxin domain-containing protein ... can be seen here     ..................................................................................................................