                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-25.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G=-19.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGTTCCGGCCAGCCGCATGAAGACGATCTCCTACGGCAAGGAAAAGCCGGTCGCAGTT
TGCGACGACATTTCCTGCTGGTCCCAGAACCGCCGCGCTGTGACGGTTCTCGGTGGCG
CGGGCATGTAAttgcctgacgtgattgtgaacgagaatgaaaggcggtcttcgggccgcctttcgtttttttcatagtttggccgaagttaa
gttgctttttcggttgatatggaaaaaatccggcttgcgccattccggtgcaaatcagttaaggcaggacgaatgagatgaagaaacttgtcGTG

    Atu3711 --- ftsH Gene: Atu3712     GI: 17937417     BI number: Atu3712     GOG: COG1729     Description: conserved hypothetical protein Gene: Atu3711     GI: 17937416     BI number: Atu3711     GOG: COG0037     Description: cell cycle protein MesJ/cytosine deaminase-related protei TA G  A T  t At        ga Cg       t  a Gc        gc Gc        tg        tc Gt        ta       t  g Cg       a  g       cg |  a      g  a       tg Gc        ta        gc Cg        gt        gc Gt        cg        cg G  g      a  a       gc Ta       g  a       gc Gt        ta        at Gt        cg        at Cg        cg        at T  t       gc        gc Cg        tg        tg Ta        tg        at Ta        At        at                         tttttcatagtttggccgaagttaagttgctttttcggttgatatggaaaaaatccggcttgcgccattccggtgcaaatcagttaaggcaggacgaatgagatgaagaaacttgtcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1729 Uncharacterized protein conserved in bacteria ... can be seen here [D] COG0037 Predicted ATPase of the PP-loop superfamily implicated in cell cycle control ... can be seen here     ..................................................................................................................