Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=33 nt.     Delta G=-10.90 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-11.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCGTGTGCAGGCCTTCGAGACCGAGCATGCCGGCATGGACCGAGTTGATCTCGTCCCA
GAGCTGGCGGGCCGGGGCTTCTCTTGCTTCAGTCAGGCTGACCATCTGTTTTCTCCTT
CCGGGTTTAACGCTGCGACGGAGAGACAACAAAGGTTCTTCCGCCGTGTTCATgatcagaa
cgaggagcggataaatcagttccttctattgtttgcggaagagaaagtgcttgcgggcttgaacgacaggcttatcgcacttataaggcccgcaatctcc
aaattaagacaatcgggttttccATG

    Atu3727


Gene: Atu3727     GI: 17937432     BI number: Atu3727     GOG: COG0217     Description: conserved hypothetical protei


  A
C  A
A  A
A  G
 CG
 AT         a
G  |      g  t
 AT       T  c
 GC       A  a
 AT        Cg
 GT        Ta
 GC        Ta        aa
C  |       Gc       t  a
A  |       Tg        at
 GC       |  a       gc
 CG       |  g      g  a
 GC       G  g       cg
T  C      C  a       gt
 CG        Cg        at
 GT        Gc        gc
 CG        Cg        gc
 AT        Cg        at
 AT        Ta        gt
                        ctattgtttgcggaagagaaagtgcttgcgggcttgaacgacaggcttatcgcacttataaggcccgcaatctccaaattaagacaatcgggttttccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG0217 Uncharacterized conserved protein ... can be seen here

    ..................................................................................................................