                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:132 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G= -9.29 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTGTTTCGGACGATTTCACCTATATTTCGACGGCGGGCGGCGCCTTCCTTGAATGG
ATGGAAGGCAAGGAATTGCCAGGCGTTGCCATCCTGACCACTGCCAAGTAAactcatcttac
ttgcctgacaaaaggccggacaagcgatgcttgtccggccttgttttttggtaagtggcaccgggaggaaaagtttcaaacgattgaaatcatttcaatc
gtttcaatgagttagcgtgccatttccctgccctggaacttctgttatcggaaatttattgtgccttgggagaatagcaaATG

    Atu3740 Gene: Atu3740     GI: 17937445     BI number: Atu3740     GOG: COG3588     Description: fructose bisphosphate aldolas CC G  A TA CG AT C  A C  A A  a G  c       ca T  t      a  a C  c      g  a C  a       ta T  t       cg         a A  c       cg       g  t C  t       gc        cg C  t      t  c       gc G  a       tg        at T  c       cg        at T  t      |  a       cg Gt       |  c       at Cg       |  a       gc Gc       a  a       gc Gc       t  g       cg At       t  c       cg Cg        cg        gc C  a       ta        gc Gc        at        at Ta        cg        at                         gttttttggtaagtggcaccgggaggaaaagtttcaaacgattgaaatcatttcaatcgtttcaatgagttagcgtgccatttccctgccctggaacttctgttatcggaaatttattgtgccttgggagaatagcaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG3588 Fructose-1,6-bisphosphate aldolase ... can be seen here     ..................................................................................................................