                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:164 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaccaaaaattaagctttctgagagattactatacatgtccagttcttctggacctcaggcatcttctccatacggcgaattggtctgatttttctccct
gttttaccttgagagccgctttcgcggctctttttttgccggtcgccggaattcgtaaaactgtgggtattaacccttctttaataattgccttgcgcat
ttcaggtaaagataccatcctgaaaacactaaaggccggaacaaaatatcccggtcgtcgttgcctgacagtgtggtgcgtgagcagggatttaaagaaa
ATG

    Atu3742 Gene: Atu3742     GI: 17937447     BI number: Atu3742     GOG: COG5317     Description: conserved hypothetical protei            ct           t  c           t  c           t  c           t  t            tg ta        at a  c       gt cg       t  t cg       c  t t  c       ta cg        gc ta        gc        tt ta       |  t      t  c c  t      t  t       cg t  t      t  g       gc a  g      a  a       cg cg       a  g       cg gt       g  a       gc gc        cg        at at        gc        gc cg        gc        at ta        cg        gt                         tttttgccggtcgccggaattcgtaaaactgtgggtattaacccttctttaataattgccttgcgcatttcaggtaaagataccatcctgaaaacactaaaggccggaacaaaatatcccggtcgtcgttgcctgacagtgtggtgcgtgagcagggatttaaagaaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5317 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................