Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTCAACTGCGCGCTCGTCTCCCCGTCACAATTGAACTGCACGACGGACGCGAACAGC
CAGTTCTCGCTCACGCGTCAAGGCTGAtaacctcgccttttcaatgagatgaccttctgaaacgcgcgcctccggcgtgc
gtttttctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaa
tgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG

    Atu3770


Gene: Atu3770     GI: 17937475     BI number: Atu3770     GOG: COG0737     Description: 5'-nucleotidas


  a
a  c
t  c
 At
 Gc
T  |
 Cg
 Gc         g
 Gc       t  a
 At       a  c
 At        gc
C  t       at         c
T  t       gt       t  c
G  c      t  c       cg
C  a      a  |       cg
G  a       at        gc
C  |       cg        cg
 At        ta        gt
 Cg        ta        cg
 Ta        ta        gc
 Cg       t  c       cg
|  a      c  |       at
 Gt        cg        at
 Cg        gc        at
 Ta        cg        gt
                        tctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaatgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.70 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -4.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTCAACTGCGCGCTCGTCTCCCCGTCACAATTGAACTGCACGACGGACGCGAACAGC
CAGTTCTCGCTCACGCGTCAAGGCTGAtaacctcgccttttcaatgagatgaccttctgaaacgcgcgcctccggcgtgc
gtttttctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaa
tgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG

    Atu3770


Gene: Atu3770     GI: 17937475     BI number: Atu3770     GOG: COG0737     Description: 5'-nucleotidas


            c
          t  a
          t  a
           tt
           tg
           ca
          c  g
  a       g  |
a  c       ca
t  c       tt         c
 At        cg       t  c
 Gc        ca        cg
T  |       ac        cg
 Cg       a  c       gc
 Gc       t  |       cg
 Gc        At        gt
 At        Gt        cg
 At        Tc        gc
                        gtttttctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaatgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here

    ..................................................................................................................