                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=2 nt.   Size=27 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGTCAACTGCGCGCTCGTCTCCCCGTCACAATTGAACTGCACGACGGACGCGAACAGC
CAGTTCTCGCTCACGCGTCAAGGCTGAtaacctcgccttttcaatgagatgaccttctgaaacgcgcgcctccggcgtgc
gtttttctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaa
tgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG

    Atu3770 Gene: Atu3770     GI: 17937475     BI number: Atu3770     GOG: COG0737     Description: 5'-nucleotidas   a a  c t  c At Gc T  | Cg Gc         g Gc       t  a At       a  c At        gc C  t       at         c T  t       gt       t  c G  c      t  c       cg C  a      a  |       cg G  a       at        gc C  |       cg        cg At        ta        gt Cg        ta        cg Ta        ta        gc Cg       t  c       cg |  a      c  |       at Gt        cg        at Cg        gc        at Ta        cg        gt                         tctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaatgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:158 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G=-10.70 kcal/mol Antiterminator: Size=33 nt.     Delta G= -4.70 kcal/mol Anti-antiterminator:   Size=20 nt.     Delta G= -4.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGTCAACTGCGCGCTCGTCTCCCCGTCACAATTGAACTGCACGACGGACGCGAACAGC CAGTTCTCGCTCACGCGTCAAGGCTGAtaacctcgccttttcaatgagatgaccttctgaaacgcgcgcctccggcgtgc gtttttctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaa tgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG     Atu3770 Gene: Atu3770     GI: 17937475     BI number: Atu3770     GOG: COG0737     Description: 5'-nucleotidas             c           t  a           t  a            tt            tg            ca           c  g   a       g  | a  c       ca t  c       tt         c At        cg       t  c Gc        ca        cg T  |       ac        cg Cg       a  c       gc Gc       t  |       cg Gc        At        gt At        Gt        cg At        Tc        gc                         gtttttctttattgcgcaactgtcatatttcgcttgcggcgactgccgctaaatggaaacatcccgttttgaaagactgacatgattttggattagagaatgagcacggccggcggatgatcaaccggcccgggcttccgctttgaacaggagagagggaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0737 5'-nucleotidase/2',3'-cyclic phosphodiesterase and related esterases ... can be seen here     ..................................................................................................................