                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTTGATGGAGACGTGAggatcatcaacgccagcaatcgtaaccgagctgcgcgggaccggggggtagtggcgaaaatcgacggcc
cccattatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccg
gtttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccttgcaggacaaatccgatttgaccgggtttctcaatggcgtgac
catcacgcggaacATG

    Atu3815 Gene: Atu3815     GI: 17937520     BI number: Atu3815     GOG: COG1802     Description: transcriptional regulator, GntR famil   t c  g g  c a  g gc cg cg a  g a  a t  c        a gc       a  a cg       a  t tg        gc |  g       cg a  g      g  a a  g      g  c cg       t  g gt       g  | |  a      a  | |  g       tg at        gc cg        gc cg        gc gc        gc cg        gc             attatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccggtttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccttgcaggacaaatccgatttgaccgggtttctcaatggcgtgaccatcacgcggaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:204 nt.     Distance to run of Ts=1 nt.   Size=29 nt.     Delta G=-12.80 kcal/mol Antiterminator: Size=46 nt.     Delta G=-13.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTTTTGATGGAGACGTGAggatcatcaacgccagcaatcgtaaccgagctgcgcgggaccggggggtagtggcgaaaatcgacggcc cccattatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccg gtttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccttgcaggacaaatccgatttgaccgggtttctcaatggcgtgac catcacgcggaacATG     Atu3815 Gene: Atu3815     GI: 17937520     BI number: Atu3815     GOG: COG1802     Description: transcriptional regulator, GntR famil   t c  g g  c a  g gc cg cg a  g a  a t  c        a gc       a  a cg       a  t tg        gc |  g       cg a  g      g  a a  g      g  c cg       t  g gt       g  | |  a      a  | |  g       tg at        gc cg        gc cg        gc gc        gc cg        gc             attatttgcttctttcatgaacgacttgcttggaaatcatgggagaggttggttgcgggcgtgaaaccggctaaagaaatttttaccggtgagtccggtttttgatgggagacgacggacgtgtcaaaacaagaggcgaatgcgggccattccttgcaggacaaatccgatttgaccgggtttctcaatggcgtgaccatcacgcggaacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1802 Transcriptional regulators ... can be seen here     ..................................................................................................................