                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:154 nt.     Distance to run of Ts=1 nt.   Size=17 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -7.62 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-18.64 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCACGCTGAAGATCGAGGCATGGACCCGCAGGCACTATCAGGATTCACGCGACAAGG
TCACCGAAGCCGTCTTCATCATGGTTGCCGTGGATGAGAATGGCGAGCCACGCCCGGT
GCGCAAGGAGGCGTGAagcccccgttcttttcaaagcaaattctcaagcgccggctaaaagaccgaagagcatggcgcttttgccttc
tcgcgaacggataatcattcactcaatactttagaaatatccaatttatttatcaatttttgcgatcaagatgtggaataggacggggatcaggctTTG

    Ser Gene: Atu3860     GI: 17937564     BI number: Atu3860     GOG: COG0726,COG3919     Description: conserved hypothetical protei   T T  G GC GC TG AT |  G CG TA AT CG TA T  G C  A TA GT CG         G CG       C  C GC       G  A A  G      T  A A  A      G  G        G G  G      G  G      T  A C  C      C  A      G  a C  C       CG        Cg A  A       CG        Gc C  C       GC        Gc TG        CG       A  c GC        AT        Gc GC        CG        Gc                         gttcttttcaaagcaaattctcaagcgccggctaaaagaccgaagagcatggcgcttttgccttctcgcgaacggataatcattcactcaatactttagaaatatccaatttatttatcaatttttgcgatcaagatgtggaataggacggggatcaggctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0726 Predicted xylanase/chitin deacetylase ... can be seen here [R] COG3919 Predicted ATP-grasp enzyme ... can be seen here     ..................................................................................................................