Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:146 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-10.19 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=78 nt.     Delta G=-15.35 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTAATCTGATGATTTGTGGTCCAAGGCGGACCGGATTGTCATATTTATAATGCGTC
AGATGATAGATGCTCGCTTTGATCGCCATtaatctgccttgcccggttttccggtttatgcggttgtccgcccctctga
aattaccgggattttgtgcaatgcaggaaaagaaagcaaggatcatttccgggggtagaacattgttggttgaggccgcgctgtctgcctcaggaagaat
ggtccgggcttatcaatcatcgccgctgagatttcgccgcgattgtggacaaggtcgaacagcGTG

    Atu3864


Gene: Atu3864     GI: 17937568     BI number: Atu3864     GOG: -------     Description: hypothetical protei


  A
G  T
A  G
T  C
 AT
 GC
 TG
|  C
 AT
 GT
 AT
 CG
 TA
|  T
 GC
 CG
|  C
 GC
 TA
 AT                  tg
 At                 t  t
 Ta                  gc
A  a                 gc
T  t                 cg
T  c                 gc
T  t                |  c
A  g                |  c
T  c       tt       |  c
A  c      t  t      |  t
C  t       gc       |  c
T  t       gc       |  t
G  g       cg       |  g
T  c       cg       |  a
T  |      c  t      t  a
A  |      g  t      a  a
 Gc       t  t      t  t
 Gc       t  a      t  t
 Cg       c  t       ta
 Cg        cg        gc
 At        gc        gc
 Gt        tg        cg
 Gt        cg        cg
                        gattttgtgcaatgcaggaaaagaaagcaaggatcatttccgggggtagaacattgttggttgaggccgcgctgtctgcctcaggaagaatggtccgggcttatcaatcatcgccgctgagatttcgccgcgattgtggacaaggtcgaacagcGTG


    ..................................................................................................................