                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=3 nt.   Size=33 nt.     Delta G=-14.30 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCTCGCGGACAAGCTGGCGTGAGTTGGAGCGAATGTCGTTTATGGGGGGAAATTGT
TCGGTCAAGTTCGATCCATTGTGGTTGCATCTTGCAACTATAACCATattgcatctggcttgcca
agattgcgtccggcgtaaaaagctggccttctgcgcaaaagcgggcaatctgctggccgggacactgacaatggcggtgaaaccgctcttttcagtaagg
tggatattctccaaggtcgcaccgtggagctctcccgcggtattcgcgagcgtttattatccggctatggagaagacATG

    Atu3872 Gene: Atu3872     GI: 17937576     BI number: Atu3872     GOG: -------     Description: hypothetical protei             t           c  c           g  t           a  c            gc            gc            tg            gc   g        cg c  c       cg t  a       at gc       |  a gc       |  t a  g      |  t at       |  c cg        cg cg        gc ta        cg cg        ta             gcgtttattatccggctatggagaagacATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:86 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -7.70 kcal/mol Antiterminator: Size=38 nt.     Delta G=-13.20 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G=-11.50 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAGCTCGCGGACAAGCTGGCGTGAGTTGGAGCGAATGTCGTTTATGGGGGGAAATTGT TCGGTCAAGTTCGATCCATTGTGGTTGCATCTTGCAACTATAACCATattgcatctggcttgcca agattgcgtccggcgtaaaaagctggccttctgcgcaaaagcgggcaatctgctggccgggacactgacaatggcggtgaaaccgctcttttcagtaagg tggatattctccaaggtcgcaccgtggagctctcccgcggtattcgcgagcgtttattatccggctatggagaagacATG     Atu3872 Gene: Atu3872     GI: 17937576     BI number: Atu3872     GOG: -------     Description: hypothetical protei            aa           c  a           g  a   a        cg a  a       gc t  a       tg g  a       cg cg        tg gc       |  c        a gt       |  a      a  t cg       |  a      c  g cg       |  t      a  g |  c      |  c       gc |  c      |  t       tg |  t      |  g       cg |  t      |  c       at |  c      t  t       cg |  t       cg       |  a tg        cg       a  a gc        gc       g  a cg        gc        gc gc        tg        gc ta        cg        cg                         ctcttttcagtaaggtggatattctccaaggtcgcaccgtggagctctcccgcggtattcgcgagcgtttattatccggctatggagaagacATG     ..................................................................................................................