Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=51 nt.     Delta G= -6.48 kcal/mol
Anti-antiterminator:   Size=17 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tccaagcggcctttcgtcgtttaaggcagggctttaaaggcaatgaaatggcgtacaaaatcttgtgcgccccttaaaggagataaattgtgccgcaatt
tatctccggcaaagatccgtcgtcgctaaagcaacgacgtaaccgcgacattcggccttgccgaatgcgctggaCGCGGGGTGGAGCAG
CCCGGTAGCTCGTCAGGCTCATAACCTGAAGGCCGCAGGTTCAAATCCTGCCCCCGCA
ACCAAAAtttaaacccaatatcaaaagggctccgaggaaactcggagccctttTTG

    SSU --- 5S


Gene: Atu3945     GI: 17937642     BI number: Atu3945     GOG: -------     Description: conserved hypothetical protein
Gene: Atu3946     GI: 17937643     BI number: Atu3946     GOG: COG0454     Description: conserved hypothetical protei


            a
          t  a
          t  a
          t  c
          A  c
          A  c
          A  a
          A  a
          C  t
          C  a
          A  t
          A  c
          C  a
          G  a
          C  a
          C  a
           Cg        aa
           Cg       g  a
           Cg        gc
  A        Gc        at
C  A      |  t       gc
T  A      |  c       cg
T  T      |  c       cg
 GC       |  g       ta
 GC        Ta        cg
 AT        Cg        gc
 CG        Cg        gc
 GC        Ta        gc
                        tttTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[KR] COG0454 Histone acetyltransferase HPA2 and related acetyltransferases ... can be seen here

    ..................................................................................................................