                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:158 nt.     Distance to run of Ts=1 nt.   Size=21 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.30 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

Tcatgtgtctcacatcgctggaaacaccagtatggtcttgccaagcagatttccctgctctttttcgtacaatttcagtggaatgctctgttttgcggtt
ggaggcgggcctaaagagcgcgggcgaacgcgcatcatttcttctcgggttgcgggcggcctcgtccacggccgcatgcagtcgcgtgactgcctagcga
gcagttgatgaagctccaacttaatacaatatgtagagccattaaatagcaggtgaatgtcgtatgggctacagtctccccagttgaaggatctgcagtt
ATG

    Atu3948 --- arcB --- Atu3950 Gene: Atu3948     GI: 17937645     BI number: Atu3948     GOG: COG3616     Description: conserved hypothetical protein Gene: arcB     GI: 17937646     BI number: Atu3949     GOG: COG2423     Description: ornithine cyclodeaminase Gene: Atu3950     GI: 17937647     BI number: Atu3950     GOG: COG1012     Description: aldehyde dehydrogenas   a g  a g  t tg gc at        gg c  c      c  g t  t       gc t  |       gc tg        at at       |  a at       g  a c  t      g  a at        tg tg        ta gc       g  g cg        gc tg        cg |  t       gc t  t      t  |       cg tg       t  |      g  a tg       t  |      g  a ta       t  |       gc cg       g  |       cg t  |      t  |       gc cg        cg        cg gc        tg        gc tg        cg       |  a cg        gc        at cg        tg        gc                         atttcttctcgggttgcgggcggcctcgtccacggccgcatgcagtcgcgtgactgcctagcgagcagttgatgaagctccaacttaatacaatatgtagagccattaaatagcaggtgaatgtcgtatgggctacagtctccccagttgaaggatctgcagttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG3616 Predicted amino acid aldolase or racemase ... can be seen here [E] COG2423 Predicted ornithine cyclodeaminase, mu-crystallin homolog ... can be seen here [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................