Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G=-16.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCACCGTGCCGGGCGTACCCATTTCATCACCATAATAAAGGTGATAAACGCTGGGTT
CGTCGAAGTTGACGGTCTTCTTCACCCGGCGCAGGCCGAGCGTATCGGTGAAAAAGCT
GTTGTTCTGCCGCGCATCCGACGCCATCGAGGTAACGTGGTGCAGGCCCTTGATATCC
TTGATCATCATcggcgcctttcgtggtcgctgtgtttgtttcgatggacaaagatgtaacccgcttgatcacgttgcggaattgcaatattt
ctctcgaatgaattgcgatttttgaaataatgcgATG

    Atu3978


Gene: Atu3978     GI: 17937675     BI number: Atu3978     GOG: COG0583     Description: transcriptional regulator, LysR famil


            G
          T  A
          T  T
          C  A
  C       C  T
T  G      C  C
A  A       GC
 CG        GT
 CG        AT
 GT        CG
C  A      |  A
A  A      |  T       tc
 GC        GC       t  g
 CG        TA       t  t
|  T       GT        cg
 CG        GC        cg
 TG        TA       |  t
 AT       |  T       gc
 CG        Gc        cg
 GC        Cg        gc
C  A      A  g       gt
G  |      A  c       cg
 CG        Tg       T  |
 CG        Gc        At
 GC        Gc        Cg
                        tttgtttcgatggacaaagatgtaacccgcttgatcacgttgcggaattgcaatatttctctcgaatgaattgcgatttttgaaataatgcgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[K] COG0583 Transcriptional regulator ... can be seen here

    ..................................................................................................................