                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-19.20 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G=-27.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

cctgtgccgaggatctgatcacattgaataaaatcaattacttgcagatcctcgggacaagcccgaggatgacgtaggcgtgattgccacgatttttcat
tgccattattggccccaagaattccgtagcacagcccgagccggcaatttgcccttctaaaaagccggcgtccggacttgcatggcagctattcagaaaa
taaggttgtctgacaaggttcggccgtaacatatggtcgacacccacctcattcacccccaatactcttttgccggcggcagtcggatagcggttttctt
ATG

    Atu4011 Gene: Atu4011     GI: 17937707     BI number: Atu4011     GOG: COG0697     Description: conserved hypothetical protei aa t  a a  a at gc ta ta at |  t c  a        a a  c      c  a c  t      a  g t  t       gc a  g       gc gc        gc ta        cg cg        ta ta        cg at        cg gc        ta        ga gc        at       t  t at       |  g       gt gc       g  a       cg cg       a  c       gc cg        cg        gc g  g       gt       a  | ta        ta        ta gc        tg        gc ta        cg        cg                         atttttcattgccattattggccccaagaattccgtagcacagcccgagccggcaatttgcccttctaaaaagccggcgtccggacttgcatggcagctattcagaaaataaggttgtctgacaaggttcggccgtaacatatggtcgacacccacctcattcacccccaatactcttttgccggcggcagtcggatagcggttttcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here     ..................................................................................................................