                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=3 nt.   Size=25 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-14.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAGTTGCGGGAAGTCACAGGTCGCGGTCGTTTTCGCGCCTGGGGCATGCTTTAAccgt
caccgcactctgcaaaggcccggaaaacggcagtatcttaggccttttttcttgaaaaccgccgcagcaatgccgcgatcacgaatcttaacaaaattta
actattgcgtaggtgggcgaagcgtctatgttccccgctgcgttgcagcacgatttcttctccggcaacgcggtcgcattcggcccggcaacttttctgt
gccgcccgcatttaagtgtccaccatgagggagatgcaataATG

    Atu4014 Gene: Atu4014     GI: 17937710     BI number: Atu4014     GOG: COG1396     Description: transcriptional regulato ct t  a gt cg g  |        t at       t  c at       t  t gc        at c  |       gc gc       c  t gc       a  c       at gc       c  c      c  t tg       g  g       gc gc       a  |       cg gt        cg        tg |  g       gc        gc |  c       ta        gc a  g       ta       c  | t  t       gc        gc gt        cg        cg cg        gc       a  | gc        tg       a  | ta        cg        cg tg        gt        gc                         aacttttctgtgccgcccgcatttaagtgtccaccatgagggagatgcaataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1396 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................