                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:36 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-16.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAATGGAAGGGTTCCTTCATTGTCGGTGGCCTGGTGAGTCAGGGTCTCGTTATCCTGC
ACATCGACGGCGACAAGGTCGCGACCGAAAGCCGCCTGCCGCTTGAAGCGCGTATCCG
CGACGTCAAGATCGGGCCGGATGGCGCGGTCTACGCCGTGACGGAAGAGCGTGGTGGT
GGAAACTCGCAGATTCTGCGGATCGCCAAGGCCGGTTGAgaaaactcgtgatcggaacgacaggctgccgg
aacgaaggcggcctgtttttcgtttgccgcagcgcgaaacctgccgggaaaaacaATG

    Atu4036 Gene: Atu4036     GI: 17937732     BI number: Atu4036     GOG: COG3569     Description: DNA topoisomeras   T A  T GC        aa AT       a  a CG        gc GC        At CG        Gc TG       |  g C  A      |  t A  T       Tg A  C       Ta A  G       Gt GC        Gc        ac GC        Cg       a  g TA        Cg       g  a G  A      |  a      g  a G  G      |  a       cg TG       |  c       cg GC       G  g       gc GC       G  a       tg TG       A  c       cg G  |      A  a       gc CG        Cg        gc GT        Cg        at AT        Gc        cg                         tttttcgtttgccgcagcgcgaaacctgccgggaaaaacaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG3569 Topoisomerase IB ... can be seen here     ..................................................................................................................