                                                                        Gene putatively regulated by attenuation in A_tumefaciens_C58_UWash_linear

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tattttcaatcggtggcggataattccgccgccgattttttatgcatggttttgggcgtggcgcgatccagcggcgctgttaccgatatcatggatttgc
gatgaggccgcggcctcaagcagcgcaatccgctatgatgccggggattccagtctcatatttggcgaccctgaccgtcctttgccgatctgccccaccg
gtttgcacattttgacgcaggtcaaaaaggtgatttgctgcctgcggttttttgcgttatcgaaatttcagaaattactgaaaattcaggaagtgaagaa
ATG

    Atu4088 Gene: Atu4088     GI: 17937784     BI number: Atu4088     GOG: COG1510     Description: transcriptional regulato   c c  c c  a g  c t  c cg tg at gt c  t cg gc                   g ta                 g  t |  c                a  g |  a                a  a |  t                 at t  t                 at t  t                 at c  t                 cg cg        ca       |  c ta       g  g      |  t gc        cg        tg cg        at        gc c  |       gc        gc a  |       ta        at gc        ta        cg ta        ta        gc cg        ta        cg                         gttttttgcgttatcgaaatttcagaaattactgaaaattcaggaagtgaagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1510 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................